▎ 摘　　要

NOVELTY - Single-stranded DNA (ssDNA) aptamer, comprising a fully defined sequence of 79 nucleotides (SEQ ID NO: 1), a sequence of SEQ ID NO: 2, a fully defined sequence of 79 nucleotides (SEQ ID NO: 3), a fully defined sequence of 79 nucleotides (SEQ ID NO: 4) and a fully defined sequence of 79 nucleotides (SEQ ID NO: 5), as given in the specification, is new. USE - The ssDNA aptamer is useful for detecting N-acetylneuraminic acid (claimed). ADVANTAGE - The aptamer: has high binding specificity and affinity to N-acetylneuraminic acid. DETAILED DESCRIPTION - Single-stranded DNA (ssDNA) aptamer, comprising a fully defined sequence of 79 nucleotides (SEQ ID NO: 1), 5'ggaaaagaatttatcttgtcc3' (SEQ ID NO: 2), a fully defined sequence of 79 nucleotides (SEQ ID NO: 3), a fully defined sequence of 79 nucleotides (SEQ ID NO: 4) and a fully defined sequence of 79 nucleotides (SEQ ID NO: 5), as given in the specification, is new INDEPENDENT CLAIMS are also included for: (1) a composition for detecting N-acetylneuraminic acid, comprising the ssDNA aptamer; (2) a kit for detecting N-acetylneuraminic acid, comprising the ssDNA aptamer; (3) a test paper for detecting N-acetylneuraminic acid, comprising the ssDNA aptamer; (4) a chip for detecting N-acetylneuraminic acid, comprising the ssDNA aptamer; and (5) a fluorescent biosensor for detecting N-acetylneuraminic acid, comprising the ssDNA aptamer, a fluorescent group and a fluorescent quenching agent.