▎ 摘　　要

NOVELTY - A fusion protein HFBI-RGD gene, having a 267 base pair sequence (SEQ ID NO: 1) fully defined in the specification, is new. USE - The fusion protein HFBI-RGD gene is used as dispersant to disperse graphene, carbon nanotubes, and hydrophobic fluorescent probes in fields of tumor diagnosis, and drug delivery. ADVANTAGE - The fusion protein HFBI-RGD gene act as an emulsifier to stabilize small oil droplets in water, and solves the problem of hydrophobic material dispersion. DETAILED DESCRIPTION - INDEPENDENT CLAIMS are included for the following: (1)protein expressed by the fusion protein HFBI-RGD gene having a 88 amino acid sequence (SEQ ID NO: 2) fully defined in the specification; (2)plasmid containing the fusion protein HFBI-RGD gene is constructed by performing PCR by using the HFBI nucleotide sequence having a 294 base pair sequence (SEQ ID NO: 3) fully defined in the specification of Trichoderma reesei as a template, and F1 as a forward primer and R1 as a reverse primer to obtain PCR product, further performing PCR second time using the first PCR product as a template and F1 as the forward primer and R2 as the reverse primer to obtain the first sequence containing the fusion protein HFBI-RGD gene, which is digested with T4 DNA ligase, ligating and constructing the fusion protein HFBI-RGD gene on the PET-28a vector to obtain a PET-28a-HFBI-RGD plasmid, further performing PCR third time using PET-28a-HFBI-RGD plasmid as template and F2 as the forward primer and R3 as the reverse primer to obtain the second sequence containing the fusion protein HFBI-RGD gene, which is digested and T4 DNA-ligated and constructing fusion protein HFBI-RGD gene on the pPIC9k vector to obtain the pPIC9k-HFBI-RGD plasmid, where the nucleotide sequence of F1 having a 36 base pair sequence (SEQ ID NO: 6) fully defined in the specification, R1 a 32 base pair sequence (SEQ ID NO: 7) fully defined in the specification, R2 having a 33 base pair sequence (SEQ ID NO: 8) fully defined in the specification and F2 having SEQ ID NO: 9, R3 having a 37 base pair sequence (SEQ ID NO: 10) fully defined in the specification and nucleotide sequence of the fusion protein HFBI-RGD gene having SEQ ID NO. 11; and (3)recombinant strain comprising the fusion protein HFBI-RGD gene, is constructed by electrotransforming pPIC9k-HFBI-RGD plasmid into the Pichia pastoris GS115 strain. ggaattcagcaacggcaacggcaatgt (SEQ ID NO: 9) and gcaaatggcattctgacatcc (SEQ ID NO: 11).