▎ 摘　　要

NOVELTY - crRNA comprises the nucleotide sequence having 20 nucleobases, which are tatatgataagccattatac, and 21 nucleobases, which are ctattatagcatcagcatca, is new. USE - crRNA for preparing kit, and detecting reagent for detecting monkeypox virus (all claimed). ADVANTAGE - The crRNA accurately identifies monkey pox virus, has important application and popularization value for the early detection and prevention and control of the monkey pox virus. DETAILED DESCRIPTION - An INDEPENDENT CLAIM is included for a method for utilizing monkey pox virus detection reagent, comprising: a. forming the Cas protein and the crRNA to form the complex, and mixing the nucleic acid of the detection sample with the complex and adding it to the field-effect transistor for detection.