▎ 摘　　要

NOVELTY - A biosensor comprises at least one electrode covered by a matrix of chitosan and carbon nanotubes and connected to a probe. The electrode is connected to a transducer element and the probe comprises ssDNA having sequence SEQ ID NO: 1 with an amino group and a 12-carbon chain at one end of the chain. USE - Biosensor used for detecting biomarker prostate cancer gene 3 (PCA3) for detecting, monitoring and diagnosing of prostate cancer. ADVANTAGE - The biosensor has high sensitivity, selectivity and does not provide false positives in detection. The nanotubes contribute significantly to the transmission of the electrical and electrochemical signal, thereby increasing the sensitivity of the biosensor. Since chitosan is an insulating material, its association with carbon nanotubes to provide the biosensor having excellent electrical properties, and facilitates the electrical response generated by the hybridization between the probe and the analyte for the diagnosis of prostate cancer. The efficient immobilization of the active layer ensures greater selectivity in detecting the complementary strand of PCA3 and interference from non-specific binding is avoided. DETAILED DESCRIPTION - A biosensor comprises at least one electrode covered by a matrix of chitosan and carbon nanotubes and connected to a probe. The electrode is connected to a transducer element and the probe comprises ssDNA having sequence SEQ ID NO: 1 with an amino group and a 12-carbon chain at one end of the chain. tttttttcccagggatctctgtgcttcc (SEQ ID NO: 1).