▎ 摘　　要

NOVELTY - Performing an immunoassay method for activating horseradish peroxidase based on oxidized graphene light involves placing 0.5g of graphite raw material and 0.5g of sodium nitrate in 16.5mL of 98% sulfuric acid at a temperature of 0 degrees C, stirring at room temperature for 24 hours, keeping in an ice bath for 10 minutes, adding 3g of potassium permanganate slowly to the mixture, and continuing stirring for 1 hour. USE - Method for performing an immunoassay method for activating horseradish peroxidase based on oxidized graphene light (claimed). ADVANTAGE - The method enables to perform an immunoassay method for activating horseradish peroxidase based on oxidized graphene light, which provides a new way for ultra-sensitive enzyme-linked immunoassay. DETAILED DESCRIPTION - Performing an immunoassay method for activating horseradish peroxidase based on oxidized graphene light involves placing 0.5g of graphite raw material and 0.5g of sodium nitrate in 16.5mL of 98% sulfuric acid at a temperature of 0 degrees C, stirring at room temperature for 24 hours, keeping in an ice bath for 10 minutes, adding 3g of potassium permanganate slowly to the mixture, and continuing stirring for 1 hour. 40mL Of deionized water is added to the mixture after stirring at a constant temperature for a certain period of time, followed by adding 1400mL of deionized water and 30% hydrogen peroxide to terminate the reaction. The obtained reaction product is filtered, washed multiple times with 5% hydrochloric acid, and dried at a temperature of 50 degrees C to obtain graphene nanomaterial. An alpha-fetoprotein secondary antibody and a nucleotide sequence comprising 21 nucleobases (SEQ ID NO: not defined), that are 5'-SH-(CH2) 6-aaaaaagaaggaggggcgact-3', are immobilized on gold nanoparticles to form gold NPs/Ab2/DNA1 complex as a signal tag for induced detection of signal generation. The gold NPs/Ab2/DNA1 complex is prepared by boiling 100mL of 0.01% chloroauric acid solution under vigorous stirring, rapidly adding 2.5mL of 1% trisodium citrate solution, and continuing stirring to cool to room temperature to get gold nanoparticles when the color of the solution changes from yellow to wine red. 40 mu L Of the alpha-fetoprotein secondary antibody at a concentration of 0.1mg/mL is mixed with 1.0mL of gold nanoparticles at room temperature for 2 hours, and then the captured DNA 1 is added and allowed to stand overnight. The inactive sites of the reaction solution are blocked with bovine serum albumin solution, and washing is performed three times with centrifugation at a speed of 12000 revolutions per minute (rpm), followed by re-dispersing in 200 mu L of 1% bovine serum albumin solution. 20 mu L Of 0.1mg/mL alpha-fetoprotein primary antibody is immobilized in a 96-well plate, washed after adding bovine serum albumin solution, and then antigen alpha-fetoprotein solution is added for full immune response, which is followed by the addition of 25 mu L of gold NP/Ab2/DNA1 complex in 96-well plate. 30 mu L Of the biotinylated nucleotide sequence of DNA 2 at a concentration of 5 mu M and biotin-labeled DNA 3 at a concentration of 5 mu M are labeled with avidin-labeled horseradish peroxidase, and incubated, where DNA 2 and DNA 3 are labeled with biotin-(CH2) at the 5' end and comprises 30 nucleobases (SEQ ID NOs: not defined), that are ggggcgacttgaaacagtcgcccctccttc and gtttcaagtcgccccgaaggaggggcgact. 10 mu L Of 50mg/L of graphene oxide solution is added to the incubated solution, which is followed by adding 100 mu L of acetic acid buffer solution with a pH of 3.0 and 20 mu L of 5mmol/L horseradish peroxidase, treating with a xenon lamp at a temperature of 40 degrees C and power of 300 watt, and then irradiating the microplate with visible light at a wavelength of 400nm for 15 minutes. The absorption spectra of the oxidized substrate is then determined by a microplate reader.