▎ 摘　　要

NOVELTY - Microbioelectrode involves modifying the gold microelectrode with reduced graphene oxide to incorporate deoligonucleotide probes, immobilizing adsorption of the sequence oligonucleotide probe comprising 20 nucleobases of ctgtgttgatgttgttggcg on the microelectrode modified. The complementary target of nucleotide sequence comprises 20 nucleobases of cgccaacaacatcaacacag is detected indirectly in real time, by monitoring the oxidation peak of the anionic probe potassium ferrocyanide on the microbial electrodes, using the differential pulse voltammetry technique. The genomic DNA of Alicyclobacillus acidoterrestris present in fruit pulp contaminated with a cell lysate, in an indirect and real-time way, by monitoring the oxidation peak of the potassium ferrocyanide anion probe on the microbioelectrode using the technique differential pulse devolution. USE - Microbioelectrode for detection of bacterium Alicyclobacillus acidoterrestris. ADVANTAGE - The microbioelectrode improves the sensitivity, specificity, and stability of recognition rates, has geometric area top, and efficiently and accurately, offers the possibility of guaranteeing the safety and quality of products traded.