▎ 摘　　要

NOVELTY - Method for detecting DNA methylation, involves (a) obtaining DNA sequence chosen from ccgg sequence modified with fluorescent radical probe DNA and probe DNA with complementary target gene DNA, standard methylation target gene DNA, methylation target gene DNA and DNA methylation by chemical agent methylation target gene DNA, and (b) performing hybridization of DNA double-chain hybridization probe DNA with target gene DNA, adding graphene oxide and restriction enzyme, and observing methylation, double-chain DNA and fluorescence recovery degree of graphene oxide. USE - The method is useful for detecting DNA methylation (claimed). ADVANTAGE - The method enables to detect DNA methylation simply, rapidly and conveniently. DETAILED DESCRIPTION - Method for detecting DNA methylation, involves (a) obtaining DNA sequence chosen from ccgg sequence modified with fluorescent radical probe DNA and probe DNA with complementary target gene DNA, standard methylation target gene DNA comprising base pair sequence of SEQ ID NO: 1, methylation target gene DNA obtained by methylate transferase comprising base pair sequence of SEQ ID NO: 2 and DNA methylation by chemical agent methylation target gene DNA comprising base pair sequence of SEQ ID NO: 3, and (b) performing hybridization of DNA double-chain hybridization probe DNA with target gene DNA, adding graphene oxide and restriction enzyme, and observing methylation, double-chain DNA and fluorescence recovery degree of graphene oxide to detect methylation. acccggataagatgctacttactcac (SEQ ID NO: 1) and agcatcttatccgggt (SEQ ID NO: 2). An INDEPENDENT CLAIM is included for kit, which comprises 25 mu m/ml graphene oxide, restriction enzyme HpaII, probe DNA containing one end CCGG sequence modified with fluorescent radical, probe DNA with complementary target gene DNA and 33 mM tris-acetic acid buffer system (pH 7.2).