▎ 摘　　要

NOVELTY - Probe set comprises first probe, which is obtained by complementary hybridization of three single-stranded DNA molecules, and three single-stranded DNA molecules comprises nucleotide sequence (SEQ ID NOS: 3-5), given in the specification. The probe set comprises a second probe, which is obtained by complementary hybridization of two single-stranded DNA molecules, and two single-stranded DNA molecules comprises nucleotide sequence (SEQ ID NOS: 1-2), given in the specification. The third probe is a single-stranded DNA molecule, and comprises 49 nucleotide sequence (SEQ ID NO: 6), given in the specification. USE - Probe set used in reagent or kit and biosensor for detecting transcription factor, such as NF-kB, preferably NF-kB p50 (all claimed). ADVANTAGE - The probe set prepares biosensor that detects NF-kB with good specificity and high sensitivity. DETAILED DESCRIPTION - Probe set comprises first probe, which is obtained by complementary hybridization of three single-stranded DNA molecules, and three single-stranded DNA molecules comprises nucleotide sequence (SEQ ID NOS: 3-5), given in the specification, and are gactttcccagtcgtcatcagatatccct and cctttccaccatttc. The probe set comprises a second probe, which is obtained by complementary hybridization of two single-stranded DNA molecules, and two single-stranded DNA molecules comprises nucleotide sequence (SEQ ID NOS: 1-2), which are gaggggactttcccagtcgtcatcagata and gatgacgactgggaaagtcccctc. The third probe is a single-stranded DNA molecule, and comprises 49 nucleotide sequence (SEQ ID NO: 6). INDEPENDENT CLAIMS are included for the following: (1) a reagent or kit for detecting transcription factor, which comprises probe set; (2) a biosensor, which comprises first probe; (3) a method for preparing a biosensor for detecting transcription factor, which involves using Ru(dcbpy)32+ and gold nanoparticles modified polyethyleneimine modified graphene oxide to prepare a luminous body; adsorbing luminous body on the glassy carbon electrode to obtain a glassy carbon electrode that adsorbs the luminous body; connecting gold nanoparticles on the glassy carbon electrode that adsorbs the luminophore to the first probe to obtain a biosensor, where first probe is obtained by complementary hybridization of DNA3, DNA4 and DNA5, and DNA3 is single-stranded DNA molecule having nucleobases (SEQ ID NO: 3), DNA4 is single-stranded DNA molecule having nucleobases (SEQ ID NO: 4), and DNA5 is single-stranded DNA molecule having nucleobases (SEQ ID NO: 5); and (4) a method for detecting transcription factor, which involves using probe set, reagent or kit and biosensor to detect transcription factors.