▎ 摘　　要

NOVELTY - A microRNA (miRNA) marker comprising one or more of miRNA-210 comprising a base pair sequence of SEQ ID NO: 1, miRNA-200b comprising a base pair sequence of SEQ ID NO: 2, miRNA-21 comprising a base pair sequence of SEQ ID NO: 3 and cel-miR-39 comprising a base pair sequence of SEQ ID NO: 4, is new. USE - The microRNA (miRNA) marker is useful in kit for diagnosing ovarian cancer and in screening of tumor diagnostic drugs for human ovarian cancer. The miRNA marker is a human serum miRNA marker (all claimed). ADVANTAGE - The miRNA marker distinguishes patients with benign ovarian tumors from ovarian cancer, has a guiding role in identifying ovarian cancer patients with different International Federation of Gynecology and Obstetrics (FIGO) stages and diagnoses ovarian cancer with improved sensitivity, specificity and diagnostic efficiency. DETAILED DESCRIPTION - A miRNA marker comprising one or more of miRNA-210 comprising a base pair sequence of SEQ ID NO: 1, miRNA-200b comprising a base pair sequence of SEQ ID NO: 2, miRNA-21 comprising a base pair sequence of SEQ ID NO: 3 and cel-miR-39 comprising a base pair sequence of SEQ ID NO: 4, is new. ugugcgugugacagcggcug (SEQ ID NO: 1), uaauacugccugguaaugauga (SEQ ID NO: 2), acactccagctgggtagcttatcagactg (SEQ ID NO: 3), and gcgtcaccgggtgtaaatc (SEQ ID NO: 4). An INDEPENDENT CLAIM is included for kit, which comprises one or more sets of primers and probes chosen from primers and probes of the miRNA-210, primers and probes of the miRNA-200b, primers and probes of the miRNA-21 and primers and probes of the cel-miR-39.