▎ 摘　　要

NOVELTY - An antisense nucleic acid molecule comprising base pair sequences of SEQ ID NOs: 1-3, is new. USE - The antisense nucleic acid molecule is useful for screening novel Coronavirus antisense nucleic acids and preparing antisense drug for preventing and/or treating novel Coronavirus infection (claimed). ADVANTAGE - The antisense nucleic acid molecule has highest fluorescence recovery ratio of 75.35-88.46%, high specificity and detects antisense nucleic acid in a simple and rapid manner. DETAILED DESCRIPTION - An antisense nucleic acid molecule comprising base pair sequences of SEQ ID NOs: 1-3, is new. ctacgtgcccgccgaggagaat(SEQ ID NO: 1), ctgactagagactagtggcaat(SEQ ID NO: 2), and ttgcagcaggatccacaagaac(SEQ ID NO: 3). INDEPENDENT CLAIMS are included for the following: method for screening novel Coronavirus antisense nucleic acid based on graphene oxide, involves mixing target gene modified with fluorescein at the 5' end and the graphene oxide solution, then adding the antisense nucleic acid to be screened, and detecting the fluorescence intensity; and antisense drug comprising the antisense nucleic acid molecule