▎ 摘　　要

NOVELTY - Sheep's pleuropneumoniae mycoplasma virus fluorescent probe comprises quenching material comprising oxidized graphite, reduced graphene or manganese dioxide; and dye-labeled artificial sequence. The artificial sequence comprises fully defined 44 nucleobases (SEQ ID NO: not defined), fully defined 36 nucleobases (SEQ ID NO: not defined), fully defined 25 nucleobases (SEQ ID NO: not defined), fully defined 44 nucleobases (SEQ ID NO: not defined), fully defined 44 nucleobases (SEQ ID NO: not defined), and fully defined 44 nucleobases (SEQ ID NO: not defined). USE - Sheep's pleuropneumoniae mycoplasma virus fluorescent probe. ADVANTAGE - The probe has fast and sensitive performance, low cost, good fluorescent visualization, accurate detection, monitoring and control, and wide application. DETAILED DESCRIPTION - A sheep's pleuropneumoniae mycoplasma virus fluorescent probe comprises quenching material and dye-labeled artificial sequence. The quenching material is oxidized graphite, reduced graphene or manganese dioxide. The dye is Cy3, Cy5, FAM or rhodamine B. The artificial sequence comprises fully defined 44 nucleobases (SEQ ID NO: not defined), fully defined 36 nucleobases (SEQ ID NO: not defined), fully defined aggtcaatacctaaaattatttctt (SEQ ID NO: not defined), fully defined 44 nucleobases (SEQ ID NO: not defined), fully defined 44 nucleobases (SEQ ID NO: not defined), and fully defined 44 nucleobases (SEQ ID NO: not defined). An INDEPENDENT CLAIM is included for detection of fluorescent probe comprising adding MO to test solution after heating at 92-97 degrees C for 3-8 minutes, cooling to 60-70 degrees C, carrying out specific complementary pairing for 3-8 minutes, and detecting by change of MO intensity.